BLASTN 2.2.20 [Feb-08-2009]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= TST-61.f
         (389 letters)

Database:
/PUBDB/blastdb/NCBI/blast/db/FASTA/2012_04_04_23_00_0/nt 
           15,920,729 sequences; 40,680,653,861 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

pdb|4ABR|A  Chain A, Complex Of Smpb, A Tmrna Fragment And E...    86   2e-13
pdb|3UZM|A  Chain A, Crystal Structure Analysis Of Ribosomal...    86   2e-13
pdb|3UZL|A  Chain A, Crystal Structure Analysis Of Ribosomal...    86   2e-13
pdb|3UZI|A  Chain A, Crystal Structure Analysis Of Ribosomal...    86   2e-13
pdb|3UZG|A  Chain A, Crystal Structure Analysis Of Ribosomal...    86   2e-13
>pdb|4ABR|A Chain A, Complex Of Smpb, A Tmrna Fragment And Ef-Tu-Gdp-Kirromycin
           With The 70s Ribosome
          Length = 1522

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
           |||||||||||||||||| ||||||||  |||||||||| ||| |||||||||  ||| |
Sbjct: 189 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 248

                                          
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
           ||||||||||||| |||  |||||| |||||
Sbjct: 249 tggtggggtaatggcccaccaaggcgacgac 279
>pdb|3UZM|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
           Entry Contains The 30s Ribosomal Subunit Of The First
           70s Molecule In The Asymmetric Unit For The Near-Cognate
           Trna-Tyr Complex With Paromomycin
          Length = 1506

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
           |||||||||||||||||| ||||||||  |||||||||| ||| |||||||||  ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243

                                          
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
           ||||||||||||| |||  |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZL|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
           Entry Contains The 30s Ribosomal Subunit Of The First
           70s Molecule In The Asymmetric Unit For The Near-Cognate
           Trna-Tyr Complex With Paromomycin
          Length = 1506

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
           |||||||||||||||||| ||||||||  |||||||||| ||| |||||||||  ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243

                                          
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
           ||||||||||||| |||  |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZI|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
           Entry Contains The 30s Ribosomal Subunit Of The Second
           70s Molecule In The Asymmetric Unit For The Near-Cognate
           Trna-Tyr Complex
          Length = 1506

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
           |||||||||||||||||| ||||||||  |||||||||| ||| |||||||||  ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243

                                          
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
           ||||||||||||| |||  |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZG|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
           Entry Contains The 30s Ribosomal Subunit Of The First
           70s Molecule In The Asymmetric Unit For The Near-Cognate
           Trna-Tyr Complex
          Length = 1506

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
           |||||||||||||||||| ||||||||  |||||||||| ||| |||||||||  ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243

                                          
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
           ||||||||||||| |||  |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
BLAST Search Results