BLASTN 2.2.20 [Feb-08-2009]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= TST-61.f
(389 letters)
Database:
/PUBDB/blastdb/NCBI/blast/db/FASTA/2012_04_04_23_00_0/nt
15,920,729 sequences; 40,680,653,861 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
pdb|4ABR|A Chain A, Complex Of Smpb, A Tmrna Fragment And E... 86 2e-13
pdb|3UZM|A Chain A, Crystal Structure Analysis Of Ribosomal... 86 2e-13
pdb|3UZL|A Chain A, Crystal Structure Analysis Of Ribosomal... 86 2e-13
pdb|3UZI|A Chain A, Crystal Structure Analysis Of Ribosomal... 86 2e-13
pdb|3UZG|A Chain A, Crystal Structure Analysis Of Ribosomal... 86 2e-13
>pdb|4ABR|A Chain A, Complex Of Smpb, A Tmrna Fragment And Ef-Tu-Gdp-Kirromycin
With The 70s Ribosome
Length = 1522
Score = 85.7 bits (43), Expect = 2e-13
Identities = 79/91 (86%)
Strand = Plus / Plus
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
|||||||||||||||||| |||||||| |||||||||| ||| ||||||||| ||| |
Sbjct: 189 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 248
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
||||||||||||| ||| |||||| |||||
Sbjct: 249 tggtggggtaatggcccaccaaggcgacgac 279
>pdb|3UZM|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
Entry Contains The 30s Ribosomal Subunit Of The First
70s Molecule In The Asymmetric Unit For The Near-Cognate
Trna-Tyr Complex With Paromomycin
Length = 1506
Score = 85.7 bits (43), Expect = 2e-13
Identities = 79/91 (86%)
Strand = Plus / Plus
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
|||||||||||||||||| |||||||| |||||||||| ||| ||||||||| ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
||||||||||||| ||| |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZL|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
Entry Contains The 30s Ribosomal Subunit Of The First
70s Molecule In The Asymmetric Unit For The Near-Cognate
Trna-Tyr Complex With Paromomycin
Length = 1506
Score = 85.7 bits (43), Expect = 2e-13
Identities = 79/91 (86%)
Strand = Plus / Plus
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
|||||||||||||||||| |||||||| |||||||||| ||| ||||||||| ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
||||||||||||| ||| |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZI|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
Entry Contains The 30s Ribosomal Subunit Of The Second
70s Molecule In The Asymmetric Unit For The Near-Cognate
Trna-Tyr Complex
Length = 1506
Score = 85.7 bits (43), Expect = 2e-13
Identities = 79/91 (86%)
Strand = Plus / Plus
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
|||||||||||||||||| |||||||| |||||||||| ||| ||||||||| ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
||||||||||||| ||| |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
>pdb|3UZG|A Chain A, Crystal Structure Analysis Of Ribosomal Decoding. This
Entry Contains The 30s Ribosomal Subunit Of The First
70s Molecule In The Asymmetric Unit For The Near-Cognate
Trna-Tyr Complex
Length = 1506
Score = 85.7 bits (43), Expect = 2e-13
Identities = 79/91 (86%)
Strand = Plus / Plus
Query: 255 ttggggtgtgtccaaaggcctttgcccctttccggatggccccccgtcccatcccctatt 314
|||||||||||||||||| |||||||| |||||||||| ||| ||||||||| ||| |
Sbjct: 184 ttggggtgtgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagt 243
Query: 315 tggtggggtaatgccccttcaaggcaacgac 345
||||||||||||| ||| |||||| |||||
Sbjct: 244 tggtggggtaatggcccaccaaggcgacgac 274
BLAST Search Results