BLASTN 2.2.20 [Feb-08-2009]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= TST-69.f
(994 letters)
Database: /PUBDB/blastdb/ddbj/16S/2012_04_06_01_00_0/16S
298,797 sequences; 305,506,631 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AB603645_1|Micrococcus sp. A02|16S rRNA 52 6e-05
M38637_1|Thermoplasma acidophilum|16S ribosomal RNA 50 3e-04
CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA 50 3e-04
BA000011_1|Thermoplasma volcanium GSS1|16S rRNA 50 3e-04
X97695_1|Pedomicrobium sp.|16S ribosomal RNA 42 0.061
>AB603645_1|Micrococcus sp. A02|16S rRNA
Length = 391
Score = 52.0 bits (26), Expect = 6e-05
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 100 ggtgaacctgcggaaggatcattaaa 125
||||||||||||||||||||||||||
Sbjct: 24 ggtgaacctgcggaaggatcattaaa 49
>M38637_1|Thermoplasma acidophilum|16S ribosomal RNA
Length = 1471
Score = 50.1 bits (25), Expect = 3e-04
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 84 taacaaggtttccgtaggtgaacctgcggaaggatca 120
||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1430 taacaaggtatccgtaggggaacctgcggatggatca 1466
>CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA
Length = 1473
Score = 50.1 bits (25), Expect = 3e-04
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 84 taacaaggtttccgtaggtgaacctgcggaaggatca 120
||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1434 taacaaggtatccgtaggggaacctgcggatggatca 1470
>BA000011_1|Thermoplasma volcanium GSS1|16S rRNA
Length = 1474
Score = 50.1 bits (25), Expect = 3e-04
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 84 taacaaggtttccgtaggtgaacctgcggaaggatca 120
||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1432 taacaaggtatccgtaggggaacctgcggatggatca 1468
>X97695_1|Pedomicrobium sp.|16S ribosomal RNA
Length = 1456
Score = 42.1 bits (21), Expect = 0.061
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 84 taacaaggtttccgtaggtgaacctgcggaaggatca 120
||||||||| ||||||| ||||||||||| ||||||
Sbjct: 1419 taacaaggtagccgtaggggaacctgcggatggatca 1455
BLAST Search Results