BLASTN 2.2.20 [Feb-08-2009]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= TST-96.f
         (628 letters)

Database: /PUBDB/blastdb/ddbj/16S/2012_04_06_01_00_0/16S 
           298,797 sequences; 305,506,631 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AB603645_1|Micrococcus sp. A02|16S rRNA                                52   4e-05
M38637_1|Thermoplasma acidophilum|16S ribosomal RNA                    50   2e-04
CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA              50   2e-04
BA000011_1|Thermoplasma volcanium GSS1|16S rRNA                        50   2e-04
X97695_1|Pedomicrobium sp.|16S ribosomal RNA                           42   0.038
>AB603645_1|Micrococcus sp. A02|16S rRNA
          Length = 391

 Score = 52.0 bits (26), Expect = 4e-05
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 484 tttaatgatccttccgcaggttcacc 509
           ||||||||||||||||||||||||||
Sbjct: 49  tttaatgatccttccgcaggttcacc 24
>M38637_1|Thermoplasma acidophilum|16S ribosomal RNA
          Length = 1471

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 489  tgatccttccgcaggttcacctacggaaaccttgtta 525
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1466 tgatccatccgcaggttcccctacggataccttgtta 1430
>CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA
          Length = 1473

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 489  tgatccttccgcaggttcacctacggaaaccttgtta 525
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1470 tgatccatccgcaggttcccctacggataccttgtta 1434
>BA000011_1|Thermoplasma volcanium GSS1|16S rRNA
          Length = 1474

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 489  tgatccttccgcaggttcacctacggaaaccttgtta 525
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1468 tgatccatccgcaggttcccctacggataccttgtta 1432
>X97695_1|Pedomicrobium sp.|16S ribosomal RNA
          Length = 1456

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 489  tgatccttccgcaggttcacctacggaaaccttgtta 525
            |||||| ||||||||||| |||||||  |||||||||
Sbjct: 1455 tgatccatccgcaggttcccctacggctaccttgtta 1419
  Database: /PUBDB/blastdb/ddbj/16S/2012_04_06_01_00_0/16S
    Posted date:  Apr 6, 2012  4:12 PM
  Number of letters in database: 305,506,631
  Number of sequences in database:  298,797
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 298797
Number of Hits to DB: 421,938,707
Number of extensions: 55072336
Number of successful extensions: 48487580
Number of sequences better than 10.0: 579980
Number of HSP's gapped: 43865160
Number of HSP's successfully gapped: 40009084
Length of database: 305,506,631
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 13 (26.3 bits)
S2: 17 (34.2 bits)