BLASTN 2.2.20 [Feb-08-2009]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= TST-43.f
(650 letters)
Database: /PUBDB/blastdb/ddbj/16S/2012_04_06_01_00_0/16S
298,797 sequences; 305,506,631 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
M38637_1|Thermoplasma acidophilum|16S ribosomal RNA 52 4e-05
CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA 52 4e-05
BA000011_1|Thermoplasma volcanium GSS1|16S rRNA 52 4e-05
AB603645_1|Micrococcus sp. A02|16S rRNA 52 4e-05
X97695_1|Pedomicrobium sp.|16S ribosomal RNA 44 0.010
>M38637_1|Thermoplasma acidophilum|16S ribosomal RNA
Length = 1471
Score = 52.0 bits (26), Expect = 4e-05
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 490 tgatccttccgcaggttcacctacggaaaccttgttac 527
|||||| ||||||||||| |||||||| ||||||||||
Sbjct: 1466 tgatccatccgcaggttcccctacggataccttgttac 1429
>CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA
Length = 1473
Score = 52.0 bits (26), Expect = 4e-05
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 490 tgatccttccgcaggttcacctacggaaaccttgttac 527
|||||| ||||||||||| |||||||| ||||||||||
Sbjct: 1470 tgatccatccgcaggttcccctacggataccttgttac 1433
>BA000011_1|Thermoplasma volcanium GSS1|16S rRNA
Length = 1474
Score = 52.0 bits (26), Expect = 4e-05
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 490 tgatccttccgcaggttcacctacggaaaccttgttac 527
|||||| ||||||||||| |||||||| ||||||||||
Sbjct: 1468 tgatccatccgcaggttcccctacggataccttgttac 1431
>AB603645_1|Micrococcus sp. A02|16S rRNA
Length = 391
Score = 52.0 bits (26), Expect = 4e-05
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 485 tttaatgatccttccgcaggttcacc 510
||||||||||||||||||||||||||
Sbjct: 49 tttaatgatccttccgcaggttcacc 24
>X97695_1|Pedomicrobium sp.|16S ribosomal RNA
Length = 1456
Score = 44.1 bits (22), Expect = 0.010
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 490 tgatccttccgcaggttcacctacggaaaccttgttac 527
|||||| ||||||||||| ||||||| ||||||||||
Sbjct: 1455 tgatccatccgcaggttcccctacggctaccttgttac 1418
BLAST Search Results