BLASTN 2.2.20 [Feb-08-2009]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= TST-32.f
         (650 letters)

Database: /PUBDB/blastdb/ddbj/16S/2012_04_06_01_00_0/16S 
           298,797 sequences; 305,506,631 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AB603645_1|Micrococcus sp. A02|16S rRNA                                52   4e-05
M38637_1|Thermoplasma acidophilum|16S ribosomal RNA                    50   2e-04
CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA              50   2e-04
BA000011_1|Thermoplasma volcanium GSS1|16S rRNA                        50   2e-04
X97695_1|Pedomicrobium sp.|16S ribosomal RNA                           42   0.040
>AB603645_1|Micrococcus sp. A02|16S rRNA
          Length = 391

 Score = 52.0 bits (26), Expect = 4e-05
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 485 tttaatgatccttccgcaggttcacc 510
           ||||||||||||||||||||||||||
Sbjct: 49  tttaatgatccttccgcaggttcacc 24
>M38637_1|Thermoplasma acidophilum|16S ribosomal RNA
          Length = 1471

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 490  tgatccttccgcaggttcacctacggaaaccttgtta 526
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1466 tgatccatccgcaggttcccctacggataccttgtta 1430
>CP001941_1|Aciduliprofundum boonei T469|16S ribosomal RNA
          Length = 1473

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 490  tgatccttccgcaggttcacctacggaaaccttgtta 526
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1470 tgatccatccgcaggttcccctacggataccttgtta 1434
>BA000011_1|Thermoplasma volcanium GSS1|16S rRNA
          Length = 1474

 Score = 50.1 bits (25), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 490  tgatccttccgcaggttcacctacggaaaccttgtta 526
            |||||| ||||||||||| |||||||| |||||||||
Sbjct: 1468 tgatccatccgcaggttcccctacggataccttgtta 1432
>X97695_1|Pedomicrobium sp.|16S ribosomal RNA
          Length = 1456

 Score = 42.1 bits (21), Expect = 0.040
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 490  tgatccttccgcaggttcacctacggaaaccttgtta 526
            |||||| ||||||||||| |||||||  |||||||||
Sbjct: 1455 tgatccatccgcaggttcccctacggctaccttgtta 1419
BLAST Search Results